Class 12 Biology Answer Key 2023, Question Paper Solution

Class 12 Biology Answer Key 2023

CBSE Class 12 Biology Answer Key 2023: The CBSE has conducted the Class 12 board exam for the Biology paper today on 16th March 2023. The complete Class 12 Biology Answer Key will be provided here as discussed by teachers for each question asked in today’s Biology Class 12 board exam. The students must be excited to know their probable scores to be scored in the Biology exam, and you can check to match your responses from our Biology Answer Key Class 12 Today Exam.

CBSE Class 12 Biology Answer Key 2023

Therefore no confirmation about the release of the official Biology Answer Key. However, students can check their probable score using the unofficial Class 12 Biology Answer Key 2023 as prepared by our subject experts and teachers in this article.

CBSE Class 12 Biology Answer Key 2023
Exam Conducting Body	Central Board of Secondary Education
Class	CBSE Class 12
Exam Name	Biology
Post Category	Answer Key
Biology Class 12 Exam Date	16th March 2023 (Thursday)
Biology Answer Key Class 12 (Unofficial )	16th March 2023
Official Website	https://www.cbse.nic.in/

Class 12 Biology Answer Key 2023 (Paper Code- 57/5/1)

CBSE has set the question papers in different sets. Here we have provided the Class 12 Biology Answer Key with Question Paper PDF along with the correct answers to the questions asked. Connect with us to get accurate Class 12 Biology Answer Key 2023 for Paper Code- 57/5/1.

Q1. At which stage evolution did human use hides to protect their bodies and buried their dead?

a) Homo habilis

b) Neanderthal man

c) Java man

d) Homo erectus

Correct Answer- b) Neanderthal man

Q2. Given below are Column A with a list of certain Assisted Reproductive Technologies (ART) and in Column B the procedures followed during ART:

Column A		Column B
SNo	Names of Art	SNo	Procedure
A	GIFT	(i)	Transfer of ovum from a donor into the fallopian tube of another female.
B	ICSI	(ii)	Transfer of semen from the donor into the vagina of the female.
C	ZIFT	(iii)	Injecting sperms directly into the ovum.
D	IUI	(iv)	Transfer of early embryos into the fallopian tube.

Choose the option where ART correctly matches with the procedure. 

a) (A)–(i), (B)–(ii), (C)–(iii), (D)–(iv) 

b) (A)–(iv), (B)–(i), (C)–(ii), (D)–(iii) 

c) (A)–(iv), (B)–(iii), (C)–(i), (D)–(ii) 

(d) (A)–(i), (B)–(iii), (C)–(iv), (D)–(ii) 

Correct Answer- (d) (A)-(i), (B)-(iii), (C)-(iv), (D)-(ii) 

Q3. The decrease in the T-lymphocytes count in human blood will result in: 

a) Decrease in antigens 

b) Decrease in antibodies 

c) Increase in antibodies 

d) Increase in antigens 

Correct Answers- d) Increase in antigens 

Q4. Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation. 

3‘ AUCAGGUUUGUGAUGGUACGA 5‘ 

a) Phenylalanine, Methionine

b) Cysteine, Glycine 

c) Alanine, Proline 

d) Serine, Valine 

Correct Answers- c) Alanine, Proline 

Q5. A Tight one-to-one relationship between many species of fig tree and certain wasps is an example of – 

(a) Commensalism 

(b) Parasitism 

(c) Amensalism 

d) Mutualism 

Correct Answers- d) Mutualism 

Q6. Select the pathogen mismatched with the symptoms of disease caused by it from the list given below

(a) Entamoeba histolvtica : Constipation, abdominal pain.

(b) Epidermophyton: Dry scaly lesions on nail

(c) Wuchereria bancrofti: Chronic inflammation of lymphatic vessels of lower limb

(d) Haemophilus influenzae : Blockage of the intestinal passage.

Correct Answer- (d) Haemophilus influenzae : Blockage of the intestinal passage.

Q7. The primary productivity in an ecosystem is expressed as:

a) gm-2 yr-1

b) gm-2 yr

c) Kcal m-2 yr-1

d) K cal m-2

Correct Answer- (d) K cal m-2

Q8. Given below is the restriction site of a restriction endonuclease Pst-I and the cleavage sites on a DNA molecule.  

Correct Answer- d)

Q9. The IUCN Red Data List (2004) in the last 500 years documents the extinction of nearly 784 species including:

a) 330 invertebrates 

b) 338 invertebrates 

c) 359 invertebrates 

d) 362 invertebrates

Correct Answer- c) 359 invertebrates 

Q10. Given below are the list of the commercially important products and their  source organisms. Select the option that gives the correct matches.

List A	List B
Bioactive Products	Microbes (Source Organism)
(A) Cyclosporin A	(i) Streptococcus
(B) Statins	(ii) Tricoderma polysporum
(C) Streptokinase	(iii) Penicillium notatum
(D) Penicillin	(iv) Monascus purpureus

Options

a) (A)-(i), (B) -(ii), (C)-(iii), (D)-(iv)

b) (A)-(iii), (B)-(iv), (C)-(ii), (D)-(i)

c) (A)-(iv), (B)-(iii), (C)-(ii), (D)-(i)

d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii)

Correct Answer- d) (A)-(ii), (B)-(iv), (C)-(i), (D)-(iii)

Q11. Important attributes belonging to a population but not to an individual are

(i) Birth rate and death rate

(ii) Male and female

(iii) Birth and death

(iv) Sex-ratio

Select the correct option from the given options :

(a) (i) only

(b) (ii) only

(c) (ii) and (iii)

(d) (i) and (iv)

Correct Answer- (d) (i) and (iv)

CBSE Class 12 Biology Answer Key & Question Paper 2023

Here, we have provided the complete Class 12 Biology Answer Key 2023 here with correct answers one by one. So if are looking for the complete CBSE Class 12 Biology Answer Key do check the questions & their answers below for

CBSE Class 12 Biology Question Paper 2023

Class 12 CBSE Biology exam 2023 is divided into five sections A, B and C. There will be overall 33 questions and students are required to answer 50 questions as per the exam pattern released for each section. The question paper will be objective and subjective in nature. There is no provision for negative marking in the CBSE 12th board examination 2022. The section divided are as follows:

1. Section A holds 16 Multiple Choice questions for 1 mark each.

2. Section B holds 5 questions of 2 marks each.

3. Section C holds 7 questions of 3 marks each.

4. Section D holds 2 case-based questions of 4 marks each.

5. Section E holds 3 questions of 5 marks each

Class 12 Biology Question Paper 2023 (57/5/1)

Class 12 Biology Question Paper 2023 Set A

 

Related Links
CBSE Class 12 Maths Syllabus 2023	CBSE Class 12 English Syllabus 2023
CBSE Class 12 Physics Syllabus 2023	CBSE Class 12 Chemistry Syllabus 2023
CBSE Class 12 Chemistry Sample Paper 2023	CBSE Class 12 Maths Sample Paper 2023
CBSE Class 12 Economics Sample Paper 2023	CBSE Class 12 English Sample Paper 2023

Sharing is caring!